Abstract
Cytosine methylation efficiently silences CpG-rich regulatory regions of genes and repeats in mammalian genomes. To what extent this entails direct inhibition of transcription factor (TF) binding versus indirect inhibition via recruitment of methyl-CpG-binding domain (MBD) proteins is unclear. Here we show that combinatorial genetic deletions of all four proteins with functional MBDs in mouse embryonic stem cells, derived neurons or a human cell line do not reactivate genes or repeats with methylated promoters. These do, however, become activated by methylation-restricted TFs if DNA methylation is removed. We identify several causal TFs in neurons, including ONECUT1, which is methylation sensitive only at a motif variant. Rampantly upregulated retrotransposons in methylation-free neurons feature a CRE motif, which activates them in the absence of DNA methylation via methylation-sensitive binding of CREB1. Our study reveals methylation-sensitive TFs in vivo and argues that direct inhibition, rather than indirect repression by the tested MBD proteins, is the prevailing mechanism of methylation-mediated repression at regulatory regions and repeats.
Similar content being viewed by others
Main
Over 80% of cytosines in the context of CpG dinucleotides are methylated in mammalian genomes. Methylation of CpG-dense promoters causes stable transcriptional repression1,2 and is the basis for long-term monoallelic silencing3, such as X chromosome inactivation and genomic imprinting4. DNA methylation is also associated with silencing of retrotransposons in somatic tissues5 and tumor suppressor genes in cancer1.
Two pathways, which are not mutually exclusive, are presumed to be responsible. The first operates in an indirect manner, via proteins that recognize methylated CpGs, as first shown for the MBD of MeCP2 (ref. 6). Based on homology, four additional MBD proteins (MBD1–4) as well as six proteins with an MBD-like domain, also known as a TAM (TIP5/ARBP/MBD) domain, were discovered7,8,9; the latter, however, did not bind methylated DNA10,11. Only four MBD proteins harbor a functional domain that binds methylated DNA in vitro and in vivo: MeCP2, MBD1, MBD2 and MBD4 (refs. 6,9,12). MBD3 harbors a mutated MBD13, which does not locate to methylated sequences in the genome9,12,13,14 and is not required for its function15. Other factors bind methylated DNA via structurally divergent domains yet require additional sequence context or are limited to hemimethylated DNA16. In contrast, 5mC-binding MBD proteins recognize symmetrically methylated CpG dinucleotides in a largely sequence-independent fashion12,16. Together with protein interaction studies and in vitro experiments, these findings have established a model in which MBD proteins recruit histone deacetylases to methylated DNA, contributing to transcriptional repression17,18,19,20,21.
The second mechanism for repression is direct obstruction of TF binding by cytosine methylation within their motif22. Although sensitivity of several TFs to methylation of their binding site has been observed in biochemical assays23,24,25,26,27,28,29, evidence in the cellular context remains scarce28,29,30.
Defining the contribution of both pathways is critical for our understanding of epigenetic silencing in mammals. Loss of individual MBD proteins results in only mild phenotypes in mice31,32,33 with the exception of MeCP2, whose mutation can cause Rett syndrome19,34,35. Combinatorial deletions of Mbd2/MeCP2 (ref. 19) or Mbd2/MeCP2/Kaiso36 in mice did not reveal a pronounced phenotype (other than Rett syndrome). Functional redundancy between MBDs has accordingly been suggested to account for the absence of severe transcriptional upregulation in the single or combinatorial knockouts generated thus far7,37. To date, no combined genetic deletion of all four MBD proteins has been reported.
Complete removal of DNA methylation has been achieved by deletion of the DNA methyltransferases (DNMTs) Dnmt1, Dnmt3a and Dnmt3b. This, however, led to rapid cell death in all tested mammalian cell types with the exception of mouse embryonic stem (ES) cells38,39,40. These are derived from preimplantation blastocysts, whose genomes are globally demethylated41. Thus, mechanisms are in place to ensure cellular function despite low DNA methylation levels, which are lost in soma42. The observed essential nature of DNMTs in other contexts has been attributed to misregulation of critical genes43, activation of repeats44 or to DNA damage and the resulting mitotic catastrophe38.
Here we aimed to tease apart the contribution of direct versus indirect modes of repression by contrasting cells lacking DNA methylation (both modes affected) and those lacking MBDs (only indirect mode affected). We generated cells lacking all four functional MBD proteins, which unexpectedly had only a minor impact on gene expression in both murine stem cells and derived neurons, as well as a human cell line. The absence of DNA methylation, however, activates genes controlled by methylated CpG islands and causes rampant transcription of retrotransposons specifically in neurons. This entails reorganization of the accessibility landscape by TFs that are methylation sensitive, driving both genic and repeat upregulation. Together, these results suggest direct inhibition of TF binding as the prevailing mode of repression of regulatory regions by DNA methylation.
Results
ES cells are viable in the absence of 5mC-binding MBD proteins
Because mouse ES cells are viable in the absence of DNA methylation42,45, we reasoned that they should be amenable to comprehensive deletions of readers of this epigenetic mark. We focused on MBD1, MBD2, MBD4 and MeCP2 (henceforth MBD proteins) as established 5mC binders in vitro and in vivo6,9,12. Using sequential CRISPR targeting we generated two independent mouse ES cell lines, using a different set of guide RNAs, that are a quadruple knockout of these four MBD protein genes (MBD–QKO) as verified by sequencing and immunoblotting (Fig. 1a and Extended Data Fig. 1a,b).
MBD–QKO ES cells are viable in culture, with normal proliferation and morphology (Fig. 1b). Also, at the level of the transcriptome, MBD–QKO ES cells closely resemble wild-type (WT) ES cells (Extended Data Fig. 1c). Only two genes are reproducibly upregulated in both clones while 33 are downregulated (Fig. 1c and Extended Data Fig. 1c–e). This limited transcriptional response is unlikely to be the result of compensatory mechanisms that follow a stronger, transient response because it was also observed following acute depletion of a single remaining MBD by small interfering RNA knockdown in a MBD triple-knockout cell line (MBD–TKO) (Extended Data Fig. 1f–i). To determine genome-wide effects on chromatin accessibility in MBD–QKO cells we performed an assay for transposase-accessible chromatin using sequencing (ATAC–seq). This revealed only minor changes in MBD–QKO, in line with the modest transcriptional response (Fig. 1d and Extended Data Fig. 1j).
To contrast loss of the tested MBD proteins with that of DNA methylation, we deleted Dnmt1/3a/3b in ES cells using CRISPR–Cas9 (DNMT–TKO), rendering ES cells free of DNA methylation. In contrast to MBD–QKO ES cells, DNMT–TKO ES cells display gene expression changes at several hundred genes, with 504 down- and 849 upregulated (Fig. 1c). Upregulated genes are enriched for being gamete specific (Extended Data Fig. 1e), because many of these are controlled by CpG-rich promoters that are methylated and silent outside of the germline46.
Profiling the chromatin accessibility landscape by ATAC–seq in DNMT–TKO ES cells identified several thousand regions that gain accessibility compared with WT (Fig. 1d). As previously observed by us using DNase-seq30, these are methylated in WT, located distally from promoters (Extended Data Fig. 1k) and contain motifs for known methylation-sensitive TFs such as NRF1 (ref. 30) or BANP47. In cells lacking MBD proteins, these sites do not gain accessibility (Fig. 1e).
In summary, while ES cells tolerate the loss of either MBD proteins or DNMTs, only the absence of DNA methylation substantially perturbs the transcriptome and genomic accessibility.
Neuronal transcriptomes in the absence of DNMT or MBD proteins
DNA methylation-independent pathways, such as trimethylation of lysine 9 of histone H3 (H3K9me3), which is mediated by SETDB1 and targeted via KRAB-ZNF proteins, are thought to account for repeat repression in DNMT–TKO ES cells42,45,48,49,50,51,52,53. As a direct test of whether this could similarly mask potential functions of MBD proteins, we reduced SETDB1 levels by siRNA transfection in WT, DNMT–TKO and MBD–QKO ES cells (Extended Data Fig. 1l). We then monitored expression levels of evolutionary young intracisternal A-type particle (IAP) repeats54 (Extended Data Fig. 1l), which showed strong upregulation only in DNMT–TKO cells and not in MBD–QKO or WT cells45. Thus, the absence of DNA methylation but not of MBD proteins causes increased sensitivity to levels of SETDB1.
Next we reasoned that a repressive role of MBD proteins might be evident only in differentiated cells, where DNA methylation becomes essential38,40,55,56,57,58,59. Testing this is hindered by the fact that DNMT–TKO cells do not differentiate when using a classic, several-week-long protocol to generate neurons42,60 (data not shown), in line with the observation that DNA hypomethylation in the adult brain causes lethality in neurons61,62. We speculated that a rapid differentiation regime might enable generation—at least for a limited time—of methylation-free neuronal cells: ectopic expression of a neurotrophic TF (NGN2) produces functional glutamatergic neurons within a few days63,64. The parental ES cell line from which all clones were derived harbors a dox-inducible Ngn2 expression cassette. Following induction of Ngn2, both DNMT–TKO and MBD–QKO cells exited the cell cycle, adopted neuronal morphology and formed axonal networks similar to WT within about 3 days (Fig. 2a and Extended Data Fig. 2a,b).
Absence of the tested MBD proteins has no detectable effect on genomic patterns of CpG methylation (Extended Data Fig. 2c). Neurons derived from both genotypes show increased CA methylation65,66,67 but at levels lower than previously observed in adult mouse brain (Extended Data Fig. 2d), probably reflecting the limited culturing time66.
Thus, neuronal cells can be generated in vitro in the absence of DNA methylation or MBD proteins using a rapid neurogenesis paradigm, allowing us to study the effects on genome regulation in a differentiated and postmitotic cell state. While the absence of MBD proteins did not affect the long-term viability of the derived neurons, DNMT–TKO neurons showed decreased viability at around 10 days following induction (Extended Data Fig. 2e–g).
The transcriptome of MBD–QKO neurons is remarkably similar to that of WT neurons, with minor but reproducible changes (168 genes down, 58 genes up) (Fig. 2b and Extended Data Fig. 2h,i). Affected genes tend to have unmethylated promoters (Fig. 2c), are already active in WT neurons (Fig. 2d) and are enriched in different pathways of tissue development (Extended Data Fig. 2j), implying that loss of MBD-mediated indirect repression at methylated regions is not the primary driver of these changes.
The transcriptome of DNMT–TKO neurons resembles that of WT neurons (Extended Data Fig. 2h), indicating that they acquire a neuronal identity in line with their morphology. However, they are more dissimilar to WT than MBD–QKO neurons, displaying a roughly tenfold larger set of differentially expressed genes (Fig. 2b). Genes upregulated in DNMT–TKO neurons tend to be under the control of promoters that are methylated (Fig. 2c), inactive in WT (Fig. 2d) and are again enriched for gamete-specific genes (Extended Data Fig. 2j). Prominent examples include Dazl and Asz1, which are known to rely on promoter methylation for repression in somatic cells46,68. These genes are not upregulated in the absence of MBD proteins (Fig. 2b,e), arguing against a prominent role of the tested MBD proteins in maintenance or establishment of repression of genes with methylated promoters that become activated in the absence of DNA methylation in neurons.
Limited derepression is conserved in human MBD–QKO cells
Before further exploring the molecular consequences of the absence of MBD proteins in neurons, we asked whether the MBD–QKO phenotype is conserved in human cells. To do so we generated a MBD–QKO from human HEK293 cells (Extended Data Fig. 3a,b). These are viable and, again, show only a limited number of genes to be misregulated (down, 309; up, 234; Extended Data Fig. 3c,d), similar to the murine system. To generate hypomethylated cells we treated WT HEK293 cells with the DNMT1 inhibitor 5-Aza-2′-deoxycytidine (Aza), which reduced global methylation from 70 to 20% (ref. 69). Again more genes change expression than in the MBD–QKO (Extended Data Fig. 3d); upregulated genes tend to have a methylated promoter, are transcriptionally inactive in the absence of the compound and are again enriched for germline genes, including DAZL (Extended Data Fig. 3d–f). In contrast, genes differentially expressed in MBD–QKO cells are already transcriptionally active and show low promoter methylation in WT (Extended Data Fig. 3e). Genome-wide methylation levels of MBD–QKO cells are comparable to those of WT HEK293 cells (Extended Data Fig. 3g) which, unlike the murine system, have virtually no CpA methylation (Extended Data Fig. 3h). This suggests that, in this human cell line, DNA methylation-mediated repression can occur only in the context of CpG yet is independent of 5mC-binding MBD proteins.
Accessibility changes following loss of DNMT, but not MBD, proteins
Having observed the similar phenotype in human cells, we proceeded to study changes in chromatin in differentiated mouse cells. The neurons showed few accessibility changes in the absence of MBD proteins (Fig. 3a and Extended Data Fig. 4a,b), while DNMT–TKO neurons showed several thousand differentially accessible regions (Fig. 3a and Extended Data Fig. 4b). The majority of sites gain accessibility, tend to locate distally from transcription start sites, are shorter than shared sites and are methylated (Extended Data Fig. 4c–e). Increased accessibility correlates with local transcriptional upregulation (Extended Data Fig. 4f). As in ES cells, known methylation-sensitive NRF1 and BANP sites gain accessibility only in the absence of DNA methylation, but not MBD, proteins (Fig. 3b). We conclude that the absence of DNA methylation, but not MBD proteins, leads to increased accessibility of regulatory regions and upregulation of neighboring genes in neurons, suggesting a contribution of methylation-sensitive TFs.
Identification of candidate methylation-sensitive TFs
The top DNMT–TKO-specific ATAC–seq peaks in neurons are enriched for 49 known TF motifs (Extended Data Fig. 5a), several with high sequence similarity (Extended Data Fig. 5b). Among those motifs strongly enriched is the one for the methylation-sensitive TF NRF1 (Fig. 3c and Extended Data Fig. 5a) that is ubiquitously expressed30. Other prominent motifs are specific to neurons, such as ONECUT1 (also known as HNF6) (Fig. 3c and Extended Data Fig. 5a). Of note, several enriched motifs do not contain a CpG, indicating that they potentially respond to non-CpG methylation despite its low prevalence in our experimental system (Extended Data Fig. 2d). More probably, however, these might not be directly linked to DNA methylation, highlighting the general need for further experimental validation.
ONECUT1 is a methylation-sensitive TF
We first tested ONECUT1, a key regulator of the nervous system, liver and pancreas70. Its canonical motif has no CpG yet a variant motif does71,72, which is enriched in DNMT–TKO-specific open regions (Extended Data Fig. 5c). Indeed, ONECUT1 binds to ~700 additional sites in DNMT–TKO neurons while only ~100 display slightly reduced binding (Fig. 3d and Extended Data Fig. 6a,b). Newly bound sites reside distally to transcription start sites (Extended Data Fig. 6c), gain accessibility (Fig. 3d and Extended Data Fig. 6d) and are enriched for the variant motif (Fig. 3e,f and Extended Data Fig. 6e). DNMT–TKO-specific peaks that contain the CpG-variant are methylated in WT neurons and show the largest increase in binding at motifs with the highest methylation (Extended Data Fig. 6f). Methylation levels of CpGs in the vicinity of the canonical motif do not correlate with differential binding in DNMT–TKO (Extended Data Fig. 6g), leading us to conclude that ONECUT1 is methylation sensitive in vivo but only at the CpG-containing motif variant. Thus new tissue-specific TFs can be identified by generation of postmitotic cells lacking DNA methylation.
DNA methylation-dependent derepression of repeats in neurons
When asking whether repeat repression is affected in neurons, we observed no significant increase in the absence of MBD proteins (Fig. 4a and Extended Data Fig. 7a). Removal of DNA methylation dramatically increased repeat-derived RNA, in particular from IAP elements, in DNMT–TKO neurons (Fig. 4a,b and Extended Data Fig. 7b). Due to this 200-fold induction (Fig. 4a), IAPs comprise one-third of repeat-derived RNA, which impacts the expression of neighboring genes68,73 (Fig. 4c) and is also evident at individual IAP retrotransposons (Extended Data Fig. 7c,d). A comparable derepression has previously been observed in Dnmt1−/− ES cells conditionally depleted of SETDB1 (ref. 74), in murine Dnmt1−/− embryos5,68 and in conditional UHRF1-depleted postnatal mouse cortex61 (Fig. 4b), suggesting that differentiated neurons in culture recapitulate the upregulation observed in vivo.
CRE is critical for IAPLTR1/1a activity
Intracisternal A-type particle elements are characterized by 5′ and 3′ long terminal repeats (LTRs) that control the expression of the viral genes54 (Fig. 5a). For correct assignment of transcriptional activity to the corresponding 5′ LTR promoter region we curated the existing RepeatMasker annotation (Extended Data Fig. 8a and Methods). This revealed that almost all copies of the evolutionarily youngest types (IAPLTR1/1a) are strongly activated (Extended Data Fig. 8b,c) while divergent LTR sequences show weaker responses (Extended Data Fig. 8c).
To identify TF motifs associated with upregulation, we asked which motifs distinguish strongly from lowly upregulated IAPLTR1/1a in DNMT–TKO neurons. This revealed the cyclic AMP response element (CRE) as the top candidate (Fig. 5a, Extended Data Fig. 8d and Methods). To test the actual contribution of this motif, we generated reporter constructs driven by IAPLTR1a with or without the CRE upstream of a luciferase reporter gene (Fig. 5b) and placed them as single-copy integrants into both WT and DNMT–TKO ES cells at a defined genomic site75. A promoter of the Pgk1 housekeeping gene (PGK) served as a positive control and, indeed, is equally active following insertion, while the IAPLTR is silent and efficiently repressed in WT and only weakly expressed in DNMT–TKO ES cells (Extended Data Fig. 8e). In WT cells this repression is preserved following differentiation into neurons, while in DNMT–TKO neurons the IAPLTR reporter is strongly upregulated, mimicking the activation of endogenous elements (Fig. 5b). Importantly, the CRE motif itself accounts for half of the observed transcriptional activity, suggesting that it is critical for full IAPLTR1/1a activity in the absence of DNA methylation.
CREB1 binds unmethylated CRE in IAP elements
Although multiple TFs of the basic leucine zipper TF family can bind CRE as homo- or heterodimers76, the cyclic AMP (cAMP)-response element-binding protein 1 (CREB1) seemed a likely candidate at IAPLTRs because it preferentially binds CRE as a homodimer in genic and viral promoters and is furthermore ubiquitously expressed77.
Measurement of CREB1 genomic occupancy revealed that binding occurs at CRE or CRE half-sites (Extended Data Fig. 8f–h), which are located almost exclusively at CpG islands of unmethylated promoters of active genes (Extended Data Fig. 8i,j), many associated with general cellular functions (Extended Data Fig. 8k). Only seven sites are bound exclusively in WT while 141 are newly bound in DNMT–TKO neurons (Extended Data Fig. 8l), mainly located distal to promoters (Extended Data Fig. 8i).
CREB1 binding signal is inversely correlated with motif methylation in WT (Extended Data Fig. 8m) and DNMT–TKO-specific binding occurs at sites that are methylated in WT (Fig. 6a,b), arguing that CREB1 is indeed methylation sensitive in vivo, as previously predicted in vitro25,28,78,79,80.
Next, we asked whether CREB1 binds 5' LTR regions of IAPLTR1/1a elements in the absence of DNA methylation. To benchmark our ability to measure occupancy at repetitive sequences, we first profiled RNA polymerase II (POL2) binding in WT and DNMT–TKO neurons (Extended Data Fig. 9a). This revealed a reproducible increase in POL2 binding at 5' LTR regions of IAPLTR1/1a elements upregulated in the absence of DNA methylation (Fig. 5c and Extended Data Fig. 9b,c) and coincides with increased accessibility (Fig. 5c and Extended Data Fig. 9b,c). As expected, we did not detect POL2 binding in WT neurons at the same LTRs (Fig. 5c and Extended Data Fig. 9b,c). Quantification of CREB1 occupancy by chromatin immunoprecipitation sequencing (ChIP–seq) revealed selective and reproducible binding in the absence of DNA methylation at IAPLTR1/1a repeats (Fig. 5c and Extended Data Fig. 9b,c), indicating CREB1 binding in a methylation-sensitive manner.
CREB1 deletion results in reduced activity at genes and IAPs
To directly test CREB1 contribution to repeat activity we deleted Creb1 in DNMT–TKO ES cells using CRISPR (Extended Data Fig. 10a,b) and generated neurons transcriptionally resembling the parent line (Extended Data Fig. 10c). Among genes bound by CREB1, the majority of responding genes were down- (n = 51) rather than upregulated (n = 9) (Extended Data Fig. 10d), in line with it being an activator77. Downregulated genes included Fsip2l (Fig. 5d), which is upregulated and bound by CREB1 at its promoter only following the removal of DNA methylation. Upregulation was reversed when Creb1 was deleted (Fig. 5d and Extended Data Fig. 10d), providing a genic example of CREB1-mediated activation following loss of DNA methylation.
Sites that are newly bound by CREB1 and that increase in accessibility following removal of DNA methylation decrease in accessibility following Creb1 deletion (Fig. 5a and Extended Data Fig. 10e,f). Thus CREB1 responds to genome demethylation by binding to new sites, leading to increased chromatin accessibility and transcriptional activation. Decreased accessibility is similarly evident at 5' LTRs of IAPLTR1/1a following loss of CREB1 in DNMT–TKO, accompanied by reduced transcriptional activity (Fig. 5e).
Taken together, the findings show that motif methylation of CRE abrogates binding of CREB1 to promoters of genes such as Fsip2l and IAP repeats. In the absence of DNA methylation, CREB1 substantially contributes to IAP upregulation. This provides a case of direct repeat repression via blockage of TF binding by motif methylation.
Discussion
Here we asked to what extent repression of regulatory regions by DNA methylation depends on direct inhibition of binding of TFs versus indirect inhibition via sequence-independent recruitment of MBD proteins. Both stable and acute deletion of four MBD proteins with established 5mC binding in murine ES cells, differentiated neurons and a human cell line caused limited transcriptional response that appears not to be linked to methylation of regulatory sequences. This challenges a scenario where indirect repression mediated by the tested MBD proteins is essential for repression of CpG-dense methylated regulatory regions. Conversely, removal of DNA methylation results in upregulation of a group of genes controlled by otherwise methylated CpG island promoters in the tested cell states, as well as rampant transcription of endogenous retroviruses in neurons. In line with this upregulation being caused by methylation-sensitive TFs, we identify and validate new factors that are blocked from binding their motifs by DNA methylation and that activate genes and retroviruses in its absence. These results suggest that direct impediment of TF binding is a prevailing mechanism of methylation-mediated repression of regulatory regions in both human and mouse.
Importantly, these observations are compatible with other proposed functions of MBD proteins—in particular MeCP2—in gene regulation, such as impacting transcriptional elongation by methyl-CA binding65,81,82, alternative splicing83,84, microRNA processing85 or protecting CA repeats from nucleosome invasion86. While MBD proteins can have a repressive function—in particular when recruited to certain sites or at transfected reporter plasmids17,18,19,87,88,89,90—our experiments argue against functional redundancy between the four tested MBD proteins as a reason for the absence of more severe transcriptional phenotypes, as hypothesized in previous loss-of-function studies of selected MBD proteins19,36. It remains conceivable that the MBD proteins we tested participate in stabilizing aspects of transcriptional repression91,92 in a way that is redundant in the cell systems we employed, yet relevant in vivo in different contexts. It remains possible that other, currently uncharacterized, sequence-agnostic methyl-CpG binding proteins exist and are able to mediate indirect repression. TAM domain proteins7,8 seem unlikely candidates because they do not bind methylated DNA10,11 and show only weak homology in the MBD domain. The plant-specific MBD5 and MBD6 are readers of methylated DNA and mediate transcriptional repression at a subset of genes and repeats93 via the recruitment of chaperone activity, yet are unrelated and nonhomologous.
In contrast to the mild phenotype of MBD deletions, we did observe that methylation of CpGs within specific motifs interferes with TF binding. Removal of DNA methylation increases chromatin accessibility, TF binding and transcription, both genome wide and in reporter assays. In addition to factors shown to be methylation sensitive in cells at their canonical motif (NRF1, BANP, CREB1), we report ONECUT1 to be methylation sensitive at only one specific CpG-containing motif variant, but not the CpG-free canonical motif. This agrees with previous in vitro observations in a SELEX-based screen28 and defines the actual contributions of these variants to the ONECUT1 binding landscape in the cellular context.
Structural data of CREB1 (ref. 94) and ONECUT1 (ref. 95) in complexes with unmethylated DNA show that both proteins interact with the major groove where the methyl group of the cytosine is positioned22, causing groove widening96. CREB1 does not bind if the central cytosine is replaced by a thymidine, which structurally resembles methyl-cytosine97. Of note, methylation can also change the DNA shape at neighboring base pairs, thus affecting binding for motifs that do not contain central CpGs29,96. It is an intriguing possibility that methylation-restricted binding at select TF motifs can function to mediate TF hierarchies30 or specifically regulate different motif variants in a cell type-specific manner, thus expanding the gene regulatory toolkit at a subset of sites. Although comparison with ancestral genomes reveals ongoing depletion of CpG-containing TF motifs98, a large fraction of promoters is rich in CpGs and these are indeed efficiently silenced by DNA methylation. We speculate that this is due to a combination of inhibition of methylation-sensitive TFs with complex motifs, but also to CXXC-domain-containing proteins that bind unmethylated CG dinucleotides and have been linked to activation99.
It is unclear whether aberrant gene expression43 or repeat activation44 causes cellular death in differentiated cells in the absence of DNA methylation96. While both processes have been linked to mitotic catastrophe in dividing cells38, our methylation-devoid neurons are postmitotic for several days before cell death, suggesting alternative scenarios in nondividing cells. Rampant repeat activation is the key feature that distinguishes these neurons, which potentially induces cell death by sheer transcriptional load, activation of the interferon pathway100 or insertion of active endogenous retroviruses (ERVs) into genes or promoter regions, thereby producing mutations or high levels of chimeric transcripts101.
Release of direct inhibition of methylation-sensitive TFs such as CREB1 contributes to repeat activation in differentiated cells. DNA methylation-independent pathways repress repeats in vertebrates during periods of global low methylation that occur in the germline as part of epigenome resetting41. Transcription and transposition in the germline is critical for genomic expansion of ERVs and thus for their evolutionary ‘success’102, whereas their activity in somatic cells would only reduce the fitness of the host. Transcriptional control by methylation-sensitive TFs could benefit the expansion of ERV by being compatible with expression in hypomethylated states in the germline while ensuring repression in somatic cells. It enables exploitation of an ubiquitously expressed activator such as CREB1 and might contribute to the fact that IAP elements are among the most active TEs in the mouse genome103.
The larger family of ERVK elements to which IAP elements belong includes human counterparts, the HERVK LTR retrotransposons, of which HERVK(HML-2) appears to replicate in the human population102. Interestingly, several human LTR retrotransposons contain CRE motifs and CREB or ATF/AP-1 factors have been implicated in driving the expression of human ERVs, human T cell leukemia virus type 1 and human immunodeficiency virus104,105,106. CRE methylation has furthermore been linked to promoter silencing of the Epstein–Barr virus genome79.
Taken together, our findings provide insights into transcriptional repression through DNA methylation of CpG-rich regulatory regions that drive genes and repeats, and favor a model of direct inhibition of TF binding as the prevailing molecular mechanism. This finding is in line with a model where genome-wide DNA methylation evolved as an efficient means to repress repetitive elements in somatic cells and was subsequently co-opted to other regulatory regions, resulting in an epigenetic marking system that remains essential at the cellular level in somatic cells.
Methods
Cell culture
HA36 mouse ES cells (mixed 129-C57Bl/6 strain, no commercial source available) were maintained in DMEM (Invitrogen), supplemented with 15% fetal calf serum (Invitrogen), 1× GlutaMax (Thermo Scientific), 1× nonessential amino acids (Gibco), 0.001% beta-mercaptoethanol (Sigma) and leukemia inhibitory factor (LIF; produced in house). All experiments were performed with cells grown for several passages on plates coated with 0.2% gelatin (Sigma).
HEK293 cells (obtained from ATCC, no. CRL-1573) were cultured in DMEM (Invitrogen), supplemented with 10% fetal calf serum (Invitrogen) and 2 mM L-Glutamine (Thermo Scientific).
Cell line generation
Ngn2 cassette integration
Mouse ES cells (HA36, 4 × 106 cells) were electroporated (mouse ES cell Nucleofector Kit, no. VPH-1001, Amaxa biosystems) in 100-µl volumes containing 95 µl of Nucleofector solution, a Piggybac plasmid containing a cassette with doxycycline-inducible Ngn2 (3.8 µg) and Dual helper construct (0.7 µg). Electroporated cells were cultivated in 2i/LIF maintenance medium (G-MEM BHK-21 medium containing 10% KnockOut serum, 1 mM sodium pyruvate, 1× nonessential amino acids, 0.1 mM B-mercaptoethanol, LIF, 1 µM PD0325901 and 3 µM CHIR99021 inhibitors) on gelatin-coated dishes. After 2 days, G418 (300 µg ml–1) was added to the cells for 2 weeks to select those that integrated the Piggybac cassette. Individual clones were then tested for Ngn2 expression and neuronal differentiation.
MBD–TKO and MBD–QKO mouse ES cells
MBD double-knockout ES cells (MBD–DKO) were generated by cotransfecting (Lipofectamine 3000, Thermo Fisher Scientific) HA36 cells containing an integrated Ngn2 cassette with two vectors, each encoding CRISPR–Cas9 and a gRNA against either Mbd2 or Mecp2. Two distinct gRNAs were used to target each gene, to generate two biological replicates. Puromycin-resistant clones were genotyped for frameshift mutations by PCR, expanded and MBD–DKO clones validated by immunoblot. To generate MBD–QKO, the same process was repeated using MBD–DKO cells with the addition of gRNAs targeting Mbd1 and Mbd4. The MBD–TKO cell line lacking Mbd1/Mbd2/Mecp2 was generated by deletion of Mbd1 from MBD–DKO with the second set of gRNAs. Details of all gRNAs used for generation of mouse ES cells can be found in Supplementary Table 1.
MBD–QKO HEK293 cells
HEK293 cells were cotransfected with plasmids encoding either CRISPR–Cas9 or the gRNA sequence with a red fluorescence protein. In a first step, MBD2 and MECP2 were targeted simultaneously and thus RFP+ HEK293 cells were sorted (BD FACS Aria III) into 96 wells and genotyped. Double-knockout clones carrying a frameshift mutation were expanded and validated by allele sequencing and immunoblot. In a second and third step, this process was repeated twice targeting MBD1 and MBD4 successively to delete all four MBD proteins. gRNAs used for HEK293 can be found in Supplementary Table 2.
DNMT–TKO mouse ES cells
The three DNMTs—Dnmt1, Dnmt3a and Dnmt3b—were deleted in HA36 ES cells with the integrated Ngn2 cassette by CRISPR–Cas9 gene editing as previously described30, to generate a DNMT–TKO line without DNA methylation. Dnmt genes of all six alleles were sequenced and residual methylation levels measured by Zymo Research, using high-pressure liquid chromatography coupled to mass spectrometry to confirm successful targeting.
CREB1–KO in DNMT–TKO mouse ES cells
Mouse HA36 DNMT–TKO ES cells generated as described above were cotransfected (Lipofectamine 3000, Thermo Fisher Scientific) with one vector encoding CRISPR–Cas9 and a gRNA (TAACTGATTCCCAAAAACGA) against Creb1, in addition to a puromycin selection marker. Puromycin-resistant clones were genotyped for frameshift mutation by PCR, expanded and validated by immunoblot.
All generated cell lines are available upon request.
Antibodies
Antibodies used in this study for immunoblot and ChIP–seq experiments are listed in Supplementary Table 3 (mouse) and Supplementary Table 4 (human).
siRNA-mediated knockdown and RNA-seq
For knockdown of Setdb1, 50,000 ES cells per well were seeded in a six-well plate and simultaneously transfected with either 7.5 µl of 20 µM Setdb1 siRNA (Dharmacon, no. M-040815-01-0005) or Allstars negative control from GeneSolution siRNA (Qiagen, no. 1027281) using Lipofectamine RNAiMAX (Invitrogen, no. 13778-075). Medium was exchanged after 24 h and transfection repeated after 48 h. Duplicates for each condition were harvested after 72 h, RNA isolated with Direct-zol RNA Microprep (Zymo research, no. R2061) and converted to complementary DNA using the PrimeScript RT reagent Kit (Takara, no. RR047A). Expression levels of genes or repeats were measured with quantitative PCR primers against Gapdh108, Setdb1 (ref. 108) or IAP-gag74. For knockdown of Mbd4, 200,000 ES cells per well were seeded in a six-well plate and simultaneously transfected with 7.5 µl of Mbd4 siRNA (20 µM) from GeneSolution siRNA (Qiagen, no. 1027416). After 24 h. cells were harvested for immunoblot or RNA-seq.
5-Aza treatment of HEK293 cells
Wild-type or MBD–QKO HEK293 cells (150,000 seeded the day before in a well of a six-well plate) were treated with either 1 μM 5-Aza-2′-deoxycytidine (no. A3656-10MG, Sigma) or DMSO in triplicate. The next day, the medium was replaced with fresh Aza or DMSO. After 72 h cells were harvested for RNA isolation.
Neuronal differentiation
For HA36 cells containing the pTRE-Ngn2 construct, differentiation was carried out by inducing expression of NGN2 with doxycycline as previously described63, with the following modifications. Cells were plated on poly-d-lysine/laminin-coated plates and treated with DMEM/F12 and Glutamax (LifeTech, no. 31331-028) containing 1× B27 without vitamin A (LifeTech, no. 12587-010), 1× N2 supplement (LifeTech, no. 17502-048), 10 ng ml–1 human epidermal growth factor (LifeTech, no. PHG0315), 10 ng ml–1 human fibroblast growth factor (LifeTech, no. CTP0261) and 1 μg ml–1 doxycycline (Sigma, no. D989) for 3 days with no medium change. At day 3 after doxycycline induction, medium was changed to Neurobasal-Medium (LifeTech, no. 21103-049) supplemented with 1× B27 and Vitamin A (LifeTech, no. 17504-044), 1× N2 (LifeTech, no. 17502-048), 10 ng ml–1 brain-derived neurotrophic factor (PeproTech, no. 450-02), 10 ng ml–1 glial cell line-derived neurotrophic factor (PeproTech, no. 450-10) and 10 ng ml–1 NT-3 (PeproTech, no. 450-03). Every other day, half of the medium was replaced with fresh. RNA-seq, ChIP–seq and ATAC–seq were performed 8 days after doxycycline induction.
Quantification of cell viability
A mix of nuclear and cell death markers (1 µl of Hoechst, 8 µl of propidium iodide and 10 µl of AnnexinV in 125 µl of AnnexinV binding buffer (Thermo Fisher, no. V13242)) were added to neuronal cell culture in six-well plates at days 8 and 10. After 15 min of incubation at 37 °C, images were acquired with a ZOE Fluorescent Cell imager (Bio-Rad, no. 145-0031) and analyzed using ImageJ109. In brief, nuclei were segmented based on Hoechst signal and the background-subtracted AnnexinV-PI signal was measured in each segmented cell. Between the two cell populations separated based on viability markers, cells without AnnexinV-PI enrichment were counted as healthy.
Recombinase-mediated cassette exchange
For targeted insertion, the IAPLTR1a_Mm consensus sequence (downloaded from repbase110) or Pgk1 promoter region (chrX:106186728-106187231, GRCm38/mm10 genome) was cloned into a plasmid containing a multiple cloning site flanked by two inverted L1 Lox sites. Recombinase-mediated cassette exchange was performed in HA36 mouse ES cells as previously described75.
Luciferase assay
Luciferase activity of ES cells or derived neurons (8 days after induction) carrying a IAPLTR1a or PGK luciferase reporter was measured with the Luciferase Assay System (Promega, no. E1500) according to the manufacturer’s instructions. Normalization was carried out by protein concentration of lysed ES cells or neurons in 1× lysis buffer with Protein Assay (Bio-Rad, no. 500006). Luminescence was measured using a luminometer (Berthold Technologies, Centro XS3 LB 960).
RNA-seq
RNA was isolated from pellets of either (1) ES or HEK293 cells with the RNeasy mini kit (Qiagen, no. 74104) using on-column DNA digestion or (2) neurons (8 days after doxycycline induction) with Direct-zol RNA Microprep (Zymo research, no. R2061) with on-column DNA digestion. Sequencing libraries were prepared from purified RNA for a minimum of two biological replicates per condition using TruSeq Stranded Total RNA Library Prep Gold (Illumina, no. 20020599). ES cell libraries were single-end sequenced on a HiSeq 2500 platform with 50 cycles. lllumina RTA 1.18.64 (HiSeq 2500) and bcl2fastq2 v.2.17 were used for base calling and demultiplexing.
HEK293 or neuron libraries were sequenced on an Illumina NextSeq platform with paired-end reads of 2 × 38 or 2 × 75 base pairs (bp), respectively. Illumina RTA 2.4.1 (NextSeq 500) and bcl2fastq2 v.2.17 were used for base calling and demultiplexing.
RNA of Mbd4 or control siRNA-treated MBD–TKO ES cells (in triplicate) was isolated using Direct-zol RNA Microprep (Zymo research, no. R2061). Sequencing libraries were prepared using TruSeq Stranded Total RNA Library Prep Gold (Illumina, no. 20020599) and paired-end sequenced on a NovaSeq 6000 platform with 2 × 56 cycles. lllumina RTA 3.4.5 (NovaSeq 6000) and bcl2fastq2 v.2.20 were used for base calling and demultiplexing.
ChIP–seq
ChIP was carried out as previously described111 with the following modifications. (1) Chromatin was sonicated for 20 cycles of 30 s using a Diagenode Bioruptor Pico, with 30-s breaks between cycles; (2) Dynabeads protein A (Invitrogen, no. 10008D) was used; and (3) DNA was purified using AMPure XP beads. Immunoprecipitated and input DNA were submitted for library preparation (NEBNext Ultra DNA Library Prep Kit, Illumina, no. E7370). In the library preparation protocol, input samples (200 ng) were amplified using six PCR cycles and immunoprecipitation samples using 12 cycles. Libraries were paired-end sequenced for 150 cycles (2 × 75 bp) on the Illumina NextSeq 500 platform. Illumina RTA 2.4.1 (NextSeq 500) and bcl2fastq2 v.2.17 were used for base calling and demultiplexing.
ATAC–seq
ATAC–seq was performed according to the protocol previously described for Omni-ATAC112 for both ES and neuronal cells. Briefly, 50,000 cells were washed with cold PBS and resuspended in lysis buffer to extract nuclei, which were then cold-centrifuged at 500g for 10 min. Nuclear pellets were incubated with transposition reaction buffer for 30 min at 37 °C. DNA was purified using the PCR Purification Kit (Qiagen). Eluted transposed DNA was amplified with 11–12 cycles of PCR using Q5 High-Fidelity Polymerase (NEB). Libraries were sequenced paired-end with 76 cycles (2 × 38 bp) on the Illumina NextSeq platform. All ATAC–seq experiments were performed in at least two independent biological replicates per condition. Illumina RTA 2.4.1 (NextSeq 500) and bcl2fastq2 v.2.17 were used for base calling and demultiplexing.
Whole-genome bisulfite sequencing
Nuclei of day 8 neurons were isolated as described by Grand et al.47 and sorted by flow cytometry (BD FACS Aria III). Genomic DNA was isolated (QIAamp DNA Micro Kit, no. 56304) from mouse ES cells or sorted neuronal nuclei and 1 µg was fragmented (Covaris S220) to an average size of ~300 bp. Libraries were prepared according to the manufacturer’s instructions. Adapter ligation was performed using the NEBNext Ultra II DNA Library Prep Kit (no. E7645L) with methylated adapters (NEBNext, no. E7535S), bisulfite treated (EZ DNA Methylation-Gold Kit; Zymo, no. D5006) and indexed (NEBNext Multiplex Oligos for Illumina) using 11 cycles in the PCR reaction (KAPA HiFi HotStart Uracil+ ReadyMix; Roche, no. 07959052001). Libraries were paired-end sequenced on a NovaSeq 6000 platform with 2 × 100 cycles. lllumina RTA 3.4.5 (NovaSeq 6000) and bcl2fastq2 v.2.20 were used for base calling and demultiplexing, with one sample per genotype. WT neuron experiments were performed in duplicate (individual differentiation experiments) and sequenced to half the coverage compared with the other samples.
HEK293 genomic DNA was isolated with a QIAamp DNA mini kit (Qiagen, no. 51306) and fragmented with Covaris S220, with 500 ng of fragmented DNA then used for library preparation (NEBNext Ultra DNA Library Prep Kit; NEB, no. E7370) with methylated adapters (NEBNext; NEB, no. E7535S) and bisulfite treated with EZ DNA methylation-lightning Kit (Zymo Research, no. D5046). Final PCR amplification was performed using a KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (Roche, no. 07959052001) with 12 cycles of amplification. One sample was prepared per genotype.
The resulting libraries were sequenced on an Illumina NextSeq platform (75 cycles, single-end). Illumina RTA 2.4.1 and bcl2fastq2 v.2.17 were used for base calling and demultiplexing.
Statistics and reproducibility
No statistical method was used to predetermine sample size. No data were excluded from the analyses. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. All statistical tests and number of observations are stated in figure panels or legends. Resulting P values are two-sided, with exceptions stated in individual figure legends.
In all boxplots, black lines correspond to median, boxes to first and third quartiles and whiskers to 1.5 times the interquartile range (IQR). Notches, if indicated, extend to ±1.58 × (IQR/sqrt(n)). Whiskers correspond to the maximum and minimum values of the distribution after removal of outliers, in which outliers were defined as >1.5 × IQR away from the box. Pearson correlation coefficients were calculated using the R function cor, with default parameters.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
Data availability
All datasets that were generated in this study were deposited at Gene Expression Omnibus (GEO, https://www.ncbi.nlm.nih.gov/geo/) under accession no. GSE184470. The following public RNA-seq datasets were obtained from GEO: P5 mouse cortex cUhrf1 KO (GSM2241736/GSM2241739/GSM2241740) and matching heterozygote (GSM2241735/GSM2241737)61; ES cSetdb1 cDnmt1 KO (GSM2059172/GSM2059173) and matching WT (GSM2059171)74; and E8.5 whole embryos Dnmt1-KO (GSM3752651/52/53) and matching WT (GSM3752646/GSM3752647/GSM3752648)68. For the analysis of non-CpG methylation, CA methylation levels of chromosome 1 from Lister et al.66 were downloaded from GEO (GSE47966). The Jaspar2018 (ref. 113) motif database used in this study can be accessed online (https://jaspar2018.genereg.net/)114,115,116,117,118,119,120,121,122,123,124,125,126,127,128. The RepeatMasker (http://www.repeatmasker.org) annotation used in this study was downloaded from the UCSC genome annotation database for the December 2011 (GRCm38/mm10) assembly of the mouse genome (ftp://hgdownload.cse.ucsc.edu/goldenPath/mm10/database/rmskOutBaseline.txt.gz). Source data are provided with this paper.
References
Jones, P. A. Functions of DNA methylation: islands, start sites, gene bodies and beyond. Nat. Rev. Genet. 13, 484–492 (2012).
Schübeler, D. Function and information content of DNA methylation. Nature 517, 321–326 (2015).
Illingworth, R. S. & Bird, A. P. CpG islands–'a rough guide’. FEBS Lett. 583, 1713–1720 (2009).
Jaenisch, R. & Bird, A. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat. Genet. 33, 245–254 Suppl. (2003).
Walsh, C. P., Chaillet, J. R. & Bestor, T. H. Transcription of IAP endogenous retroviruses is constrained by cytosine methylation. Nat. Genet. 20, 116–117 (1998).
Lewis, J. D. et al. Purification, sequence, and cellular localization of a novel chromosomal protein that binds to methylated DNA. Cell 69, 905–914 (1992).
Hendrich, B. & Tweedie, S. The methyl-CpG binding domain and the evolving role of DNA methylation in animals. Trends Genet. 19, 269–277 (2003).
Roloff, T. C., Ropers, H. H. & Nuber, U. A. Comparative study of methyl-CpG-binding domain proteins. BMC Genomics 4, 1 (2003).
Hendrich, B. & Bird, A. Identification and characterization of a family of mammalian methyl-CpG binding proteins. Mol. Cell. Biol. 18, 6538–6547 (1998).
Laget, S. et al. The human proteins MBD5 and MBD6 associate with heterochromatin but they do not bind methylated DNA. PLoS ONE 5, e11982 (2010).
Strohner, R. et al. NoRC–a novel member of mammalian ISWI-containing chromatin remodeling machines. EMBO J. 20, 4892–4900 (2001).
Baubec, T., Ivánek, R., Lienert, F. & Schübeler, D. Methylation-dependent and -independent genomic targeting principles of the MBD protein family. Cell 153, 480–492 (2013).
Saito, M. & Ishikawa, F. The mCpG-binding domain of human MBD3 does not bind to mCpG but interacts with NuRD/Mi2 components HDAC1 and MTA2. J. Biol. Chem. 277, 35434–35439 (2002).
Zhang, Y. et al. Analysis of the NuRD subunits reveals a histone deacetylase core complex and a connection with DNA methylation. Genes Dev. 13, 1924–1935 (1999).
Schmolka, N., Bhaskaran, J., Karemaker, I. D. & Baubec, T. Dissecting the roles of MBD2 isoforms in regulating NuRD complex function during cellular differentiation. Preprint at bioRxiv https://doi.org/10.1101/2021.03.17.435677 (2021).
Buck-Koehntop, B. A. & Defossez, P.-A. On how mammalian transcription factors recognize methylated DNA. Epigenetics 8, 131–137 (2013).
Nan, X. et al. Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nature 393, 386–389 (1998).
Ng, H. H. et al. MBD2 is a transcriptional repressor belonging to the MeCP1 histone deacetylase complex. Nat. Genet. 23, 58–61 (1999).
Guy, J., Hendrich, B., Holmes, M., Martin, J. E. & Bird, A. A mouse Mecp2-null mutation causes neurological symptoms that mimic Rett syndrome. Nat. Genet. 27, 322–326 (2001).
Du, Q., Luu, P.-L., Stirzaker, C. & Clark, S. J. Methyl-CpG-binding domain proteins: readers of the epigenome. Epigenomics 7, 1051–1073 (2015).
Bird, A. P. & Wolffe, A. P. Methylation-induced repression—belts, braces, and chromatin. Cell 99, 451–454 (1999).
Dantas Machado, A. C. et al. Evolving insights on how cytosine methylation affects protein–DNA binding. Brief. Funct. Genomics 14, 61–73 (2014).
Bednarik, D. P. et al. DNA CpG methylation inhibits binding of NF-kappa B proteins to the HIV-1 long terminal repeat cognate DNA motifs. New Biol. 3, 969–976 (1991).
Campanero, M. R., Armstrong, M. I. & Flemington, E. K. CpG methylation as a mechanism for the regulation of E2F activity. Proc. Natl Acad. Sci. USA 97, 6481–6486 (2000).
Iguchi-Ariga, S. M. & Schaffner, W. CpG methylation of the cAMP-responsive enhancer/promoter sequence TGACGTCA abolishes specific factor binding as well as transcriptional activation. Genes Dev. 3, 612–619 (1989).
Prendergast, G. C., Lawe, D. & Ziff, E. B. Association of Myn, the murine homolog of max, with c-Myc stimulates methylation-sensitive DNA binding and ras cotransformation. Cell 65, 395–407 (1991).
Watt, F. & Molloy, P. L. Cytosine methylation prevents binding to DNA of a HeLa cell transcription factor required for optimal expression of the adenovirus major late promoter. Genes Dev. 2, 1136–1143 (1988).
Yin, Y. et al. Impact of cytosine methylation on DNA binding specificities of human transcription factors. Science 356, eaaj2239 (2017).
Kribelbauer, J. F. et al. Quantitative analysis of the DNA methylation sensitivity of transcription factor complexes. Cell Rep. 19, 2383–2395 (2017).
Domcke, S. et al. Competition between DNA methylation and transcription factors determines binding of NRF1. Nature 528, 575–579 (2015).
Zhao, X. et al. Mice lacking methyl-CpG binding protein 1 have deficits in adult neurogenesis and hippocampal function. Proc. Natl Acad. Sci. USA 100, 6777–6782 (2003).
Hendrich, B., Guy, J., Ramsahoye, B., Wilson, V. A. & Bird, A. Closely related proteins MBD2 and MBD3 play distinctive but interacting roles in mouse development. Genes Dev. 15, 710–723 (2001).
Millar, C. B. et al. Enhanced CpG mutability and tumorigenesis in MBD4-deficient mice. Science 297, 403–405 (2002).
Amir, R. E. et al. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat. Genet. 23, 185–188 (1999).
Chen, R. Z., Akbarian, S., Tudor, M. & Jaenisch, R. Deficiency of methyl-CpG binding protein-2 in CNS neurons results in a Rett-like phenotype in mice. Nat. Genet. 27, 327–331 (2001).
Martín Caballero, I., Hansen, J., Leaford, D., Pollard, S. & Hendrich, B. D. The methyl-CpG binding proteins Mecp2, Mbd2 and Kaiso are dispensable for mouse embryogenesis, but play a redundant function in neural differentiation. PLoS ONE 4, e4315 (2009).
Fatemi, M. & Wade, P. A. MBD family proteins: reading the epigenetic code. J. Cell Sci. 119, 3033–3037 (2006).
Chen, T. et al. Complete inactivation of DNMT1 leads to mitotic catastrophe in human cancer cells. Nat. Genet. 39, 391–396 (2007).
Liao, J. et al. Targeted disruption of DNMT1, DNMT3A and DNMT3B in human embryonic stem cells. Nat. Genet. 47, 469–478 (2015).
Li, E., Bestor, T. H. & Jaenisch, R. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 69, 915–926 (1992).
Greenberg, M. V. C. & Bourc’his, D. The diverse roles of DNA methylation in mammalian development and disease. Nat. Rev. Mol. Cell Biol. 20, 590–607 (2019).
Tsumura, A. et al. Maintenance of self-renewal ability of mouse embryonic stem cells in the absence of DNA methyltransferases Dnmt1, Dnmt3a and Dnmt3b. Genes Cells 11, 805–814 (2006).
Jackson-Grusby, L. et al. Loss of genomic methylation causes p53-dependent apoptosis and epigenetic deregulation. Nat. Genet. 27, 31–39 (2001).
Yoder, J. A., Walsh, C. P. & Bestor, T. H. Cytosine methylation and the ecology of intragenomic parasites. Trends Genet. 13, 335–340 (1997).
Karimi, M. M. et al. DNA methylation and SETDB1/H3K9me3 regulate predominantly distinct sets of genes, retroelements, and chimeric transcripts in mESCs. Cell Stem Cell 8, 676–687 (2011).
Weber, M. et al. Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome. Nat. Genet. 39, 457–466 (2007).
Grand, R. S. et al. BANP opens chromatin and activates CpG-island-regulated genes. Nature 596, 133–137 (2021).
Rowe, H. M. et al. KAP1 controls endogenous retroviruses in embryonic stem cells. Nature 463, 237–240 (2010).
Matsui, T. et al. Proviral silencing in embryonic stem cells requires the histone methyltransferase ESET. Nature 464, 927–931 (2010).
Chelmicki, T. et al. m6A RNA methylation regulates the fate of endogenous retroviruses. Nature 591, 312–316 (2021).
Boulard, M., Rucli, S., Edwards, J. R. & Bestor, T. H. Methylation-directed glycosylation of chromatin factors represses retrotransposon promoters. Proc. Natl Acad. Sci. USA 117, 14292–14298 (2020).
Walter, M., Teissandier, A., Pérez-Palacios, R. & Bourc’his, D. An epigenetic switch ensures transposon repression upon dynamic loss of DNA methylation in embryonic stem cells. eLife 5, e11418 (2016).
Stolz, P. et al. TET1 regulates gene expression and repression of endogenous retroviruses independent of DNA demethylation. Nucleic Acids Res. 50, 8491–8511 (2022).
Mager, D. L. & Stoye, J. P. Mammalian endogenous retroviruses. Microbiol. Spectr. 3, MDNA3–0009–2014 (2015).
Egger, G. et al. Identification of DNMT1 (DNA methyltransferase 1) hypomorphs in somatic knockouts suggests an essential role for DNMT1 in cell survival. Proc. Natl Acad. Sci. USA 103, 14080–14085 (2006).
Fan, G. et al. DNA hypomethylation perturbs the function and survival of CNS neurons in postnatal animals. J. Neurosci. 21, 788–797 (2001).
Okano, M., Bell, D. W., Haber, D. A. & Li, E. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99, 247–257 (1999).
Sen, G. L., Reuter, J. A., Webster, D. E., Zhu, L. & Khavari, P. A. DNMT1 maintains progenitor function in self-renewing somatic tissue. Nature 463, 563–567 (2010).
Wang, Z. et al. Dominant role of DNA methylation over H3K9me3 for IAP silencing in endoderm. Nat. Commun. 13, 5447 (2022).
Jackson, M. et al. Severe global DNA hypomethylation blocks differentiation and induces histone hyperacetylation in embryonic stem cells. Mol. Cell. Biol. 24, 8862–8871 (2004).
Ramesh, V. et al. Loss of Uhrf1 in neural stem cells leads to activation of retroviral elements and delayed neurodegeneration. Genes Dev. 30, 2199–2212 (2016).
Hutnick, L. K. et al. DNA hypomethylation restricted to the murine forebrain induces cortical degeneration and impairs postnatal neuronal maturation. Hum. Mol. Genet. 18, 2875–2888 (2009).
Thoma, E. C. et al. Ectopic expression of neurogenin 2 alone is sufficient to induce differentiation of embryonic stem cells into mature neurons. PLoS ONE 7, e38651 (2012).
Zhang, Y. et al. Rapid single-step induction of functional neurons from human pluripotent stem cells. Neuron 78, 785–798 (2013).
Lagger, S. et al. MeCP2 recognizes cytosine methylated tri-nucleotide and di-nucleotide sequences to tune transcription in the mammalian brain. PLoS Genet. 13, e1006793 (2017).
Lister, R. et al. Global epigenomic reconfiguration during mammalian brain development. Science 341, 1237905 (2013).
Guo, J. U. et al. Distribution, recognition and regulation of non-CpG methylation in the adult mammalian brain. Nat. Neurosci. 17, 215–222 (2013).
Dahlet, T. et al. Genome-wide analysis in the mouse embryo reveals the importance of DNA methylation for transcription integrity. Nat. Commun. 11, 3153 (2020).
Ramos, M.-P., Wijetunga, N. A., McLellan, A. S., Suzuki, M. & Greally, J. M. DNA demethylation by 5-aza-2′-deoxycytidine is imprinted, targeted to euchromatin, and has limited transcriptional consequences. Epigenetics Chromatin 8, 11 (2015).
Audouard, E. et al. The Onecut transcription factor HNF-6 contributes to proper reorganization of Purkinje cells during postnatal cerebellum development. Mol. Cell. Neurosci. 56, 159–168 (2013).
Ballester, B. et al. Multi-species, multi-transcription factor binding highlights conserved control of tissue-specific biological pathways. eLife 3, e02626 (2014).
Wang, L. et al. MACE: model based analysis of ChIP-exo. Nucleic Acids Res. 42, e156 (2014).
Tan, S.-L. et al. Essential roles of the histone methyltransferase ESET in the epigenetic control of neural progenitor cells during development. Development 139, 3806–3816 (2012).
Sharif, J. et al. Activation of endogenous retroviruses in Dnmt1−/− ESCs involves disruption of SETDB1-mediated repression by NP95 binding to hemimethylated DNA. Cell Stem Cell 19, 81–94 (2016).
Lienert, F. et al. Identification of genetic elements that autonomously determine DNA methylation states. Nat. Genet. 43, 1091–1097 (2011).
Hai, T. & Hartman, M. G. The molecular biology and nomenclature of the activating transcription factor/cAMP responsive element binding family of transcription factors: activating transcription factor proteins and homeostasis. Gene 273, 1–11 (2001).
Steven, A. et al. What turns CREB on? And off? And why does it matter? Cell. Mol. Life Sci. 77, 4049–4067 (2020).
Mancini, D. N., Singh, S. M., Archer, T. K. & Rodenhiser, D. I. Site-specific DNA methylation in the neurofibromatosis (NF1) promoter interferes with binding of CREB and SP1 transcription factors. Oncogene 18, 4108–4119 (1999).
Tierney, R. J. et al. Methylation of transcription factor binding sites in the Epstein–Barr virus latent cycle promoter Wp coincides with promoter down-regulation during virus-induced B-cell transformation. J. Virol. 74, 10468–10479 (2000).
Spruijt, C. G. et al. Dynamic readers for 5-(hydroxy)methylcytosine and its oxidized derivatives. Cell 152, 1146–1159 (2013).
Gabel, H. W. et al. Disruption of DNA-methylation-dependent long gene repression in Rett syndrome. Nature 522, 89–93 (2015).
Tillotson, R. et al. Neuronal non-CG methylation is an essential target for MeCP2 function. Mol. Cell 81, 1260–1275 (2021).
Young, J. I. et al. Regulation of RNA splicing by the methylation-dependent transcriptional repressor methyl-CpG binding protein 2. Proc. Natl Acad. Sci. USA 102, 17551–17558 (2005).
Maunakea, A. K., Chepelev, I., Cui, K. & Zhao, K. Intragenic DNA methylation modulates alternative splicing by recruiting MeCP2 to promote exon recognition. Cell Res. 23, 1256–1269 (2013).
Cheng, T.-L. et al. MeCP2 suppresses nuclear microRNA processing and dendritic growth by regulating the DGCR8/Drosha complex. Dev. Cell 28, 547–560 (2014).
Ibrahim, A. et al. MeCP2 is a microsatellite binding protein that protects CA repeats from nucleosome invasion. Science 372, eabd5581 (2021).
Yeo, N. C. et al. An enhanced CRISPR repressor for targeted mammalian gene regulation. Nat. Methods 15, 611–616 (2018).
Kondo, E., Gu, Z., Horii, A. & Fukushige, S. The thymine DNA glycosylase MBD4 represses transcription and is associated with methylated p16(INK4a) and hMLH1 genes. Mol. Cell. Biol. 25, 4388–4396 (2005).
Nan, X., Campoy, F. J. & Bird, A. MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin. Cell 88, 471–481 (1997).
Jørgensen, H. F., Ben-Porath, I. & Bird, A. P. Mbd1 is recruited to both methylated and nonmethylated CpGs via distinct DNA binding domains. Mol. Cell. Biol. 24, 3387–3395 (2004).
Sasai, N. & Defossez, P.-A. Many paths to one goal? The proteins that recognize methylated DNA in eukaryotes. Int. J. Dev. Biol. 53, 323–334 (2009).
Tillotson, R. & Bird, A. The molecular basis of MeCP2 function in the brain. J. Mol. Biol. 432, 1602–1623 (2020).
Ichino, L. et al. MBD5 and MBD6 couple DNA methylation to gene silencing through the J-domain protein SILENZIO. Science 372, 1434–1439 (2021).
Schumacher, M. A., Goodman, R. H. & Brennan, R. G. The structure of a CREB bZIP.somatostatin CRE complex reveals the basis for selective dimerization and divalent cation-enhanced DNA binding. J. Biol. Chem. 275, 35242–35247 (2000).
Iyaguchi, D., Yao, M., Watanabe, N., Nishihira, J. & Tanaka, I. DNA recognition mechanism of the ONECUT homeodomain of transcription factor HNF-6. Structure 15, 75–83 (2007).
Kribelbauer, J. F., Lu, X.-J., Rohs, R., Mann, R. S. & Bussemaker, H. J. Toward a mechanistic understanding of DNA methylation readout by transcription factors. J. Mol. Biol. 432, 1801–1815 (2020).
Derreumaux, S., Chaoui, M., Tevanian, G. & Fermandjian, S. Impact of CpG methylation on structure, dynamics and solvation of cAMP DNA responsive element. Nucleic Acids Res. 29, 2314–2326 (2001).
Żemojtel, T. et al. CpG deamination creates transcription factor-binding sites with high efficiency. Genome Biol. Evol. 3, 1304–1311 (2011).
Long, H. K., Blackledge, N. P. & Klose, R. J. ZF-CxxC domain-containing proteins, CpG islands and the chromatin connection. Biochem. Soc. Trans. 41, 727–740 (2013).
Chiappinelli, K. B. et al. Inhibiting DNA methylation causes an interferon response in cancer via dsRNA including endogenous retroviruses. Cell 162, 974–986 (2017).
Bestor, T. H. Cytosine methylation mediates sexual conflict. Trends Genet. 19, 185–190 (2003).
Friedli, M. & Trono, D. The developmental control of transposable elements and the evolution of higher species. Annu. Rev. Cell Dev. Biol. 31, 429–451 (2015).
Maksakova, I. A. et al. Retroviral elements and their hosts: insertional mutagenesis in the mouse germ line. PLoS Genet. 2, e2 (2006).
Caselli, E., Benedetti, S., Grigolato, J., Caruso, A. & Di Luca, D. Activating transcription factor 4 (ATF4) is upregulated by human herpesvirus 8 infection, increases virus replication and promotes proangiogenic properties. Arch. Virol. 157, 63–74 (2012).
Grant, C. et al. Foxp3 represses retroviral transcription by targeting both NF-κB and CREB pathways. PLoS Pathog. 2, e33 (2006).
Toufaily, C., Lokossou, A. G., Vargas, A., Rassart, É. & Barbeau, B. A CRE/AP-1-like motif is essential for induced syncytin-2 expression and fusion in human trophoblast-like model. PLoS ONE 10, e0121468 (2015).
Jolma, A. et al. DNA-binding specificities of human transcription factors. Cell 152, 327–339 (2013).
Wu, K. et al. SETDB1-mediated cell fate transition between 2C-like and pluripotent states. Cell Rep. 30, 25–36 (2020).
Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat. Methods 9, 676–682 (2012).
Bao, W., Kojima, K. K. & Kohany, O. Repbase Update, a database of repetitive elements in eukaryotic genomes. Mob. DNA 6, 11 (2015).
Barisic, D., Stadler, M. B., Iurlaro, M. & Schübeler, D. Mammalian ISWI and SWI/SNF selectively mediate binding of distinct transcription factors. Nature 569, 136–140 (2019).
Corces, M. R. et al. An improved ATAC-seq protocol reduces background and enables interrogation of frozen tissues. Nat. Methods 14, 959–962 (2017).
Khan, A. et al. JASPAR 2018: update of the open-access database of transcription factor binding profiles and its web framework. Nucleic Acids Res. 46, D1284 (2018).
Gaidatzis, D., Lerch, A., Hahne, F. & Stadler, M. B. QuasR: quantification and annotation of short reads in R. Bioinformatics 31, 1130–1132 (2015).
Kim, D., Langmead, B. & Salzberg, S. L. HISAT: a fast spliced aligner with low memory requirements. Nat. Methods 12, 357–360 (2015).
Huber, W. et al.Orchestrating high-throughput genomic analysis with Bioconductor. Nat. Methods 12, 115–121 (2015).
Robinson, M. D. & Oshlack, A. A scaling normalization method for differential expression analysis of RNA-seq data. Genome Biol. 11, R25 (2010).
Ritchie, M. E. et al. limma Powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 43, e47 (2015).
Law, C. W., Chen, Y., Shi, W. & Smyth, G. K. voom: precision weights unlock linear model analysis tools for RNA-seq read counts. Genome Biol. 15, R29 (2014).
Robinson, M. D., McCarthy, D. J. & Smyth, G. K. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139–140 (2010).
Yu, G., Wang, L.-G., Han, Y. & He, Q.-Y. clusterProfiler: an R package for comparing biological themes among gene clusters. OMICS 16, 284–287 (2012).
Langmead, B., Trapnell, C., Pop, M. & Salzberg, S. L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 10, R25 (2009).
Zhang, Y. et al. Model-based analysis of ChIP-Seq (MACS). Genome Biol. 9, R137 (2008).
Heinz, S. et al. Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol. Cell 38, 576–589 (2010).
Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078–2079 (2009).
Lawrence, M., Gentleman, R. & Carey, V. rtracklayer: An R package for interfacing with genome browsers. Bioinformatics 25, 1841–1842 (2009).
Hahne, F. & Ivanek, R. Visualizing genomic data using Gviz and Bioconductor. Methods Mol. Biol. 1418, 335–351 (2016).
Lawrence, M. et al. Software for computing and annotating genomic ranges. PLoS Comput. Biol. 9, e1003118 (2013).
Acknowledgements
We thank M. Müller from the Novartis Institutes of Biomedical Research for providing an NGN2 expression plasmid, and C. Artus and J. Chao (FMI) for providing an NGN2-inducible murine ES cell line. We thank M. Lorincz and members of the Schübeler laboratory for critical feedback on the manuscript. D.S. acknowledges support from the Novartis Research Foundation, the Swiss National Science Foundation (no. 310030B_176394) and the European Research Council under the European Union’s Horizon 2020 research and innovation program grant agreements (nos. ReadMe-667951 and DNAaccess-884664). S. Domcke acknowledges support from the Boehringer Ingelheim Foundation, and S. Durdu acknowledges an EMBO Long-Term Fellowship.
Author information
Authors and Affiliations
Contributions
S.K., S. Domcke and D.S. conceived and planned the experiments. S.K. performed all experiments related to MBD proteins and TF binding. S.K. and S. Domcke performed experiments related to DNMT–TKO. Comprehensive computational analysis was performed by S.K. and supervised by L.B. S. Domcke performed initial data analysis with input from M.S. C.W. generated the DNMT–TKO cell line and performed initial experiments. S. Durdu analyzed the imaging experiments. D.S. supervised the project. S.K., S. Domcke and D.S. interpreted the results and wrote the manuscript.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Peer review
Peer review information
Nature Genetics thanks Taiping Chen, Maxim Greenberg, Hiroyuki Sasaki and Paul Wade for their contribution to the peer review of this work.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Extended data
Extended Data Fig. 1 ES cells are viable without 5mC-binding MBD proteins with limited changes in transcription and chromatin accessibility.
a, MBD sequences in WT and MBD-QKO clones (QKO) #1 and #2. Two sequences shown if the mutation is heterozygous (a and b). Genes with exons (black), gRNA target sites (green triangle) and MBD coding region (red). gRNA sequence highlighted (green or underlined). b, Representative Western blot of at least three independent experiments detecting MBD proteins in clones from two independent sets of gRNAs with loading control. Nuclear extracts from ES cells. MBD1 or MBD4 OE: WT ES cells overexpressing (OE) MBD protein from Baubec et al.12. WT Neurons: Nuclear extract of WT neurons (Methods). Purple color, signal saturation. M, marker. c, Unsupervised clustering of RNA-seq samples from WT and mutant ES cells (RPKM). PCC, Pearson’s correlation coefficient. d, Differentially expressed genes (red, FDR = < 0.01 and |log2FC| >= 1) between WT and MBD-QKO ES cells. Replicates from both MBD-QKO clones combined. e, Gene Ontology terms enriched among downregulated genes in MBD-QKO (excluding Mbd genes, n = 31) or upregulated genes in DNMT-TKO (n = 849) compared to WT (Methods). f, Sequence of Mbd1 for MBD-TKO ES cells (Methods) as in a. Western blots showing absence of MBD1, MBD2 and MeCP2. MBD1 WT OE as in b. g, Representative Western blot of at least two independent experiments showing MBD4 depletion in MBD-TKO cells after siRNA treatment (24 h). h, Unsupervised clustering of RNA-seq samples (RPKM) from MBD-TKO ES cells treated with control or Mbd4 siRNA. i, Number of expression changes (RNA-seq) detected in MBD-TKO cells treated with control or Mbd4 siRNA (except for Mbd4). j, Unsupervised clustering of ATAC-seq samples. Pairwise PCC of log-transformed normalized read counts in peaks indicated. k, Features of ATAC-seq peaks that are unchanged between cell lines or that are DNMT-TKO specific. Promoter proximal, distance to TSS < 1000 bp. l, RT-qPCR of Setdb1 and IAP-gag relative to Gapdh 72 h after transfection of siRNA against Setdb1 or control. Setdb1 knockdown causes strong increase in IAP activity only in DNMT-TKO cells. These cells already show moderate IAP activity in control conditions, as previously described45,74. Two biological replicates per condition (n = 2) with each measurement representing the mean of three technical replicates.
Extended Data Fig. 2 Neurons without DNMT or MBD proteins show distinct phenotypes.
a, NGN2 driven neuronal differentiation coincides with higher MeCP2 levels92 and lower MBD3 levels12 as shown by Western blot detection in nuclear extracts. Blots representative examples of at least two independent experiments. b, Western blot for MBD2 and MeCP2 validating their absence in MBD-QKO neurons. No signal was detected for MBD1 and MBD4 in WT and MBD-QKO neurons. Blots representative for at least two independent experiments. c, CpG methylation in neurons between two WT replicates and one MBD-QKO sample (down-sampled to the sample with lowest coverage and retaining only CpGs with ten-fold coverage). d, CpA methylation in WT and MBD-QKO ES and NGN2 derived neurons compared to the mouse frontal cortex of different developmental stages66. Boxplots as in Fig. 2d. e, Representative brightfield (inverted) and fluorescent composite images of WT and ten days DNMT-TKO neurons of at least four regions from two independent experiments. Live staining with Hoechst (blue) and cell death marked by AnnexinV (green) and propidium iodide (PI, red). Scale bar = 100 µm. f, Quantification of survival in neurons, measured by AnnexinV and PI signal intensities on nuclear Hoechst segmented nuclei. Cutoffs indicated by gray dashed lines. g, Boxplot of cell viability. n = cells examined over N randomly chosen regions. Day eight: WT n = 849, N = 6; MBD-QKO n = 1433, N = 10; DNMT-TKO n = 992, N = 5, day ten: WT n = 509, N = 4; MBD-QKO n = 1066, N = 8; DNMT-TKO n = 1086, N = 5. Replicates were combined. Boxplots as in Fig. 2d. h, Unsupervised clustering of RNA-seq samples from WT and mutant ES and neuron cells (RPKM). Colors indicate PCC. i, Differentially expressed genes (red, FDR = < 0.01 and |log2FC | >= 1) in MBD-QKO neurons vs WT. Mbd genes, black circles. Replicates from both MBD-QKO clones were combined. j, Gene Ontology (GO) terms enriched in the set of genes downregulated in MBD-QKO neurons (n = 168) or upregulated in DNMT-TKO neurons (n = 1100) compared to WT. The dots represent the top terms with highest gene ratio (fraction of genes represented in the given GO term) with dot size and color representing gene counts and the adjusted p-value (Fisher’s exact test), respectively.
Extended Data Fig. 3 Human HEK293 cells lacking MBD proteins show limited changes in transcription and global levels of DNA methylation.
a, Sequence of MBD loci in in HEK293 annotated as in Extended Data Fig. 1. b, Western blot for MBDs indicating absence of proteins. MBD3 protein levels unchanged (actin represents loading control). Blots representative of at least three independent experiments. c, Unsupervised clustering of RNA-seq (RPKM) samples from WT and MBD-QKO HEK293 cells treated with DMSO or 5-Aza-2′- deoxycytidine (Aza). d, Genes differentially expressed (FDR = < 0.01 and |log2FC| >= 1) are colored in blue or light green. Strongly upregulated genes in WT cells upon Aza treatment are colored in dark green (FDR = < 0.01 and log2FC > = 3). Comparing WT and MBD-QKO cells reveals that ~ 7-times more genes are upregulated upon Aza treatment, which tend to be transcriptionally silent in DMSO conditions. e, Hierarchical clustering of genes differentially expressed in MBD-QKO cells or in WT cells treated with Aza (blue or dark green points in d, n = 1265). Each row depicts the expression fold change (log2) of either: MBD-QKO vs. WT, WT treated with Aza vs. DMSO, MBD-QKO treated with Aza vs. DMSO. WT gene expression, WT promoter methylation and differentially expressed genes (DEG in black, FDR = < 0.01 and |log2FC| >= 1) are indicated. Of all genes that respond to Aza treatment in WT cells, only ~6 % (n = 20) of down- and 7 % (n = 110) of upregulated genes are also affected in MBD-QKO cells. The gene cluster with most upregulated genes under Aza treatment is marked with a red bar. These genes are largely unaffected after deletion of MBD proteins and are only de-repressed in MBD-QKO cells when treated with Aza. f, Gene ontology enrichment of genes represented in the cluster indicated by the red bar in e (Methods). g, Methylation frequencies in 1 kb windows comparing WT and MBD-QKO HEK293 cells (min. read coverage of 10 in both samples, n = ~2 mio). h, CpA methylation levels of 1 kb windows in HEK293 cells or human frontal cortex from Lister et. al.66 (windows with min. read coverage of 100 in all samples). Boxplots as in Fig. 2d.
Extended Data Fig. 4 The chromatin accessibility landscape in neurons changes in response to loss of DNA methylation but not MBD proteins.
a, Unsupervised clustering of ATAC-seq samples from WT and mutant neuron cells. Colors indicate pairwise Pearson’s correlation coefficients (PCC) of log-transformed normalized read counts in ATAC-seq peaks, indicating clear separation of DNMT-TKO from WT and MBD-QKO ES cells. b, MA plot showing mean chromatin accessibility (ATAC-seq) versus accessibility changes for neurons lacking MBD proteins or DNA methylation compared to WT. For differential accessibility analysis all replicates from both MBD-QKO clones were combined. Sites with an |log2FC| > 1 compared to WT and FDR < 0.01 are colored. c, Percent TSS-proximal ATAC-seq peaks (<1000 bp, left plot) or peaks overlapping with CpG islands (right plot) from b that do not change in any condition (unchanged, n = ~83,000), or change accessibility in DNMT-TKO (up, n = 7121 or down, n = 5606) or MBD-QKO neurons (up, n = 126 or down, n = 97). d, same as in c for ATAC-seq peak width or e, ATAC-seq peak methylation levels. Boxplots as in Fig. 2d. f, Expression change of genes closest to peaks that are unchanged between conditions or peaks that gain (up) or lose accessibility (down) in DNMT-TKO neurons binned by distance to TSS. Number of peaks per bin is indicated. Boxplots as in Fig. 2d.
Extended Data Fig. 5 Motif search in DNMT-TKO specific ATAC-seq peak regions.
a, Motif enrichment (Methods) among DNMT-TKO specific ATAC-seq peaks (FDR < 0.01 and |log2FC| > 3) vs. DNMT-TKO specific peaks with that motif in percent. Red points indicate motifs that are enriched (FDR < 0.01 and |log2FC| > 1) in DNMT-TKO specific peaks (n = 49). b, Unbiased clustering of motif similarities (position weight matrices) of motifs enriched in DNMT-TKO specific peaks colored in red in a. c, Enrichment (log2) of NRF1 or ONECUT1 hexamers in bins of differentially accessible ATAC-seq peaks between DNMT-TKO and WT neurons (Methods). Similar to NRF1, CpG-containing ONECUT1 hexamers are enriched in bins of peaks that gain accessibility in DNA methylation-deficient cells, opposed to the canonical (CpG-free) ONECUT1 hexamers.
Extended Data Fig. 6 ONECUT1 is methylation-sensitive at its CpG-containing motif variant.
a, Reproducibility of counts for two independent ONECUT1 ChIP-seq replicates from WT and DNMT-TKO neurons in merged WT and DNMT-TKO peak regions. Pearson correlation coefficients are indicated. b, Reproducibility of changes in ONECUT1 binding in DNMT-TKO versus WT neurons in all peaks regions. Number of regions that de- or increase in binding reproducibly are indicated by n. Pearson correlation coefficient is shown c, Percent of ONECUT1 peak regions distal (>1000 bp) to the transcriptional start site (TSS). Unchanged, peaks unchanged (log2FC < 1, n = 10,232) between WT and DNMT-TKO neurons or DNMT-TKO specific (n = 771, as defined in a.). d, Changes of ONECUT1 binding versus changes in chromatin accessibility (ATAC-seq) between WT and DNMT-TKO neurons in all peak regions (n = 11,121). Boxplots as in Fig. 2d. e, WT and DNMT-TKO ONECUT1 ChIP-seq signal in all peak regions. Red asterisks mark peak regions that contain the canonical ONECUT1 motif (top) or the CpG-containing variant (bottom) at least once. f, Change in ONECUT1 binding between DNMT-TKO and WT at all peak regions grouped according to their WT motif methylation. Boxplots as in Fig. 2d. g, Change in ONECUT1 binding between DNMT-TKO and WT peak regions grouped according to peak methylation, split by motif category. Grey box plots show peak regions containing the canonical motif at least once. Orange box plots show peak regions containing the CpG-containing motif variant at least once. Number above box plots indicates the number of peaks. Boxplots as in Fig. 2d.
Extended Data Fig. 7 Repeats are de-repressed in absence of DNA methylation but not MBD proteins in neurons.
a, Volcano plot showing differentially expressed repeat subfamilies in MBD-QKO neurons using random assignment of multi mapping reads. Dashed lines indicate two-fold expression change. Repeat subfamilies belonging to ERVK or simple repeats that are differentially expressed (FDR = < 0.01 and |log2FC| >= 1) are colored. b, Same as in a but for DNMT-TKO neurons. c, Reproducibility of IAP expression changes in DNMT-TKO versus WT neurons in all IAP elements annotated by RepeatMasker. Only uniquely mapping RNA-seq reads and elements with more than 8 counts in at least one condition are considered. d, RNA expression of the top six most significant differentially expressed internal sequence of class-2 endogenous retroviruses from b. Only uniquely mapping RNA-seq reads were used. Internal IAP elements selected to have more than 8 counts in at least one condition. Boxplots as in Fig. 2d.
Extended Data Fig. 8 CRE is important for IAP activity and bound by methylation-sensitive CREB1.
a, Curated RepeatMasker annotation for IAP elements. IAPLTR1a (orange) and IAPEz-int (dark grey) fragments of same ID and subfamily are merged if within 1024 bp. b, IAPs differentially expressed in DNMT-TKO (red, FDR < 0.05, |log2FC| >= 1) using uniquely mapping RNA reads and the curated annotation. c, Related IAPs are similarly de-repressed in DNMT-TKO neurons. d, TF motifs (black) in 5’LTR of expressed IAPLTR1/1a. Significance (Bonferroni-corrected one-sided Wilcoxon test) of expression difference (DNMT-TKO vs WT) between IAPLTR1 and 1a elements plus/minus motif. Cluster of motifs (red) reproducibly enriched in IAPLTR1 and 1a elements expressed in DNMT-TKO. Unbiased clustering (right) indicates that most resemble the CRE motif (TGACGTCA). e, Reporter activity in ES cells similar to Fig. 5b. IAPLTR1a reporter is silent in WT and only moderately active in DNMT-TKO ES cells. Seven biological replicates each, error bar indicates SEM. P = 0.0012, two-sided t-test. f, Reproducibility of read counts for three CREB1 ChIP-seq replicates from WT and DNMT-TKO neurons in all peak regions. Coefficients from pearson correlation. g, Top motif found by de novo motif search in the top 500 CREB1 ChIP-seq peaks shared between WT or DNMT-TKO neurons. h, Fraction of peaks with a CRE sequence for different bins of CREB1 enrichment in WT (left) or DNMT-TKO (right) neurons across three replicates. n = Number of peaks per enrichment bin. i, CREB1 peaks are located in unmethylated CpG-island promoters. n = Number of datapoints. Boxplots as in Fig. 2d. j, Gene expression of CREB1-bound and -unbound promoters in neurons. Boxplots as in Fig. 2d. k, Gene Ontology (GO) terms enriched in genes with CREB1-bound promoters (top 500). Dots represent top 10 terms with highest gene ratio (fraction of genes represented in the GO term). Dot size and color representing gene counts and adjusted P value (Fisher’s exact test), respectively. l, CREB1 binding (ChIP-seq) in DNMT-TKO versus WT cells at peak regions across cell lines indicated by red or blue circles. PCC indicated. m, CREB1 binding in WT neurons at all peak regions identified in WT and DNMT-TKO cells binned by motif methylation. Boxplots as in Fig. 2d.
Extended Data Fig. 9 Changes in POL2 and CREB1 binding or accessibility are detectable at IAPLTR1/1a in absence of DNA methylation.
a, Reproducibility of read counts for two independent POL2 ChIP-seq replicates from WT and DNMT-TKO neurons in promoter regions. Pearson correlation coefficients are indicated. b, Unsupervised clustering of changes in signal relative to mean for POL2 and CREB1 ChIP-seq or ATAC-seq samples in WT, DNMT-TKO (TKO) or CREB1-KO DNMT-TKO (TKO_CREB1-KO, only for ATAC-seq) neurons. Colors indicate pairwise Pearson’s correlation coefficients (PCC) of uniquely mapping read counts in 5’ LTRs of annotation-curated IAP elements that are de-repressed in absence of DNA methylation (RNA-seq, FDR < 0.05 and fold change > = 2). Different replicates are shown. Number of repeats 726 (IAPLTR1) or 844 (IAPLTR1a) c, Changes in chromatin accessibility (top tracks, ATAC-seq), POL2 binding (middle tracks, ChIP-seq) or CREB1 binding (bottom tracks, ChIP-seq) in WT and DNMT-TKO neurons at IAPLTR1/1a elements that gain expression in absence of DNA methylation (RNA-seq, FDR < 0.05 and fold change > = 2). Signal is centered at the start site of IAP elements (Methods). Orange bars depict average width of the 5’ LTR and dashed lines display the average length of an entire element including the 5’ and 3’ LTR regions. Only uniquely mapped reads are considered. Replicates are shown. n = number of elements.
Extended Data Fig. 10 CREB1 deletion in DNMT-TKO neurons causes reduced chromatin accessibility and transcription.
a, Scheme of Creb1 with exons in black and CRISPR cut site indicated by green triangle. Sequence below displays a 5 bp deletion in CREB1-deleted DNMT-TKO neurons. b, Western blot detecting CREB1 in nuclear extracts from WT and DNMT-TKO ES cells, which is absent in CREB1-KO cells. Lamin serves as a loading control. Blot is representative of three independent experiments. c, Unsupervised clustering of RNA-seq signals from WT and mutant neuron cells (RPKM). PCC, Pearson’s correlation coefficient. d, Volcano plot showing gene expression changes between WT or CREB1-deleted DNMT-TKO neurons. Differentially expressed genes (FDR = < 0.01 and |log2FC| >= 1) indicated by dashed lines. Orange circled points are genes that are bound by CREB1 in their promoter region, as determined by ChIP-seq. Fsip2l is indicated by a blue dot. e, Unsupervised clustering of ATAC-seq samples in all CREB1 peak regions from WT, DNMT-TKO or CREB1-KO in DNMT-TKO neurons. Colors indicate pairwise Pearson’s correlation coefficients (PCC) of log-transformed normalized read counts in ATAC-seq peaks, indicating reproducibility between replicates and separation of all three genotypes. f, Changes in chromatin accessibility (ATAC-seq) binned by CREB1 enrichments in absence of DNA methylation. Accessibility changes between WT and DNMT-TKO neurons (left) and between WT and CREB1-deleted DNMT-TKO neurons (right). Replicate samples per condition (n = 3) are combined. Number of data points indicated. Boxplots as in Fig. 2d.
Supplementary information
Supplementary Information
Supplementary Methods
Supplementary Table
gRNA and antibody information.
Source data
Source Data Fig. 1
Unprocessed immunoblots.
Source Data Extended Data Fig. 1
Unprocessed immunoblots.
Source Data Extended Data Fig. 2
Unprocessed immunoblots.
Source Data Extended Data Fig. 10
Unprocessed immunoblots.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Kaluscha, S., Domcke, S., Wirbelauer, C. et al. Evidence that direct inhibition of transcription factor binding is the prevailing mode of gene and repeat repression by DNA methylation. Nat Genet 54, 1895–1906 (2022). https://doi.org/10.1038/s41588-022-01241-6
Received:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1038/s41588-022-01241-6
This article is cited by
-
A comparison of methods for detecting DNA methylation from long-read sequencing of human genomes
Genome Biology (2024)
-
Identification of Eleutherococcus senticosus NAC transcription factors and their mechanisms in mediating DNA methylation of EsFPS, EsSS, and EsSE promoters to regulate saponin synthesis
BMC Genomics (2024)
-
Characterisation and reproducibility of the HumanMethylationEPIC v2.0 BeadChip for DNA methylation profiling
BMC Genomics (2024)
-
The impact of DNA methylation on CTCF-mediated 3D genome organization
Nature Structural & Molecular Biology (2024)
-
TET activity safeguards pluripotency throughout embryonic dormancy
Nature Structural & Molecular Biology (2024)